More
Words to look
add-list |
www.use-in-a-sentence.com
English words and Examples of Usage
Example
Sentences for "asp "
An old writer, one James Penrose of the middle ages, questions if Cleopatra applied the asp to her breast as is commonly supposed, because, as he remarks, “the veines are so very slender”.
“Petrus Victorius blames the painters who depict the Egyptian queen applying the asp to her breast, seeing it is manifest out of Plutarch in the life of Antonius, and out of Plinie likewise, that she applied it to her arme.
” “Cæsar also in her statue, which he carryed in tryumph, applyed the asp to her arme; for in the armes there are great veines and arteries which doe quickly and in a straight way convey the venom to the heart, whereas in the papps the vessels are slender.
Only when Ser224 was replaced with an Asp residue was there significant increases in the observed K m value for 6 of the 9 substrates tested, and the largest changes were exhibited when the penicillins were used as substrates.
Using TIRF microscopy, these structures, putative filaments, are not apparent in GFP-3xAsp myosin II cells in which the three potential Thr phosphorylation targets have been replaced with Asp residues (data not shown).
To test whether the fibulin-1C interaction with proHB-EGF maps to the heparin-binding region, a construct, pGBT9/prodelHB-EGF, containing amino acid residues Asp 106-His 159(the entire EGF like region of proHB-EGF and 18 out of 32 residues of the heparin-binding region) [ 2 ] was used in the yeast two-hybrid system (see materials and methods).
The EGF-like region (amino acid residues Asp 106-His 159) of monkey proHB-EGF [ 2 ] was amplified by PCR using primers MkHB-EGF 5'CTAGGGAAGGAATTCGACCCATGTCTTCGG and MkHB-EGF 3'CACAGCCAGGATGGATCCTCAATGGTCATAGG.
Three of these were part of our original group of mutations, changing conserved asp or glu residues to ala.
The genotype data were analyzed for genetic linkage with both single-marker and multipoint model-free ASP lod score analysis [ 34 ] using the computer program MAPMAKER/SIBS [ 35 ] .
In the first stage a 10 cM genome scan was performed using the Weber screening set 8 [ 32 ] and the data analyzed using both two-point and multipoint ASP linkage analysis.
All protein residues were modeled in their charged state except for one of the two aspartic acid groups (Asp 25 and Asp 25') in the active site since previous studies [ 57 58 59 ] have shown that at least one of these two aspartic acids is protonated.
We used a protonated Asp 25' and deprotonated Asp 25 for all HIV-1 protease-ligand complexes.
5 more results not shown.
Academic English Words List and Example
Sentences
Example sentences with the asp , a sentence example for asp , and
how
to make asp in sample sentence, Synonyms and Collocations for asp
how do I use the word asp in a sentence? How do you spell asp in a
sentence? spelling of asp
Search
Example Sentences for any English Word here ....
Translate
Cambridge Dictionary
Meaning
Longman Dictionary Meaning
Macmillan Dictionary
Meaning
Oxford Dictionary Meaning
Collocations
Synonyms
Share on Facebook